Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11201A5
Clone ID IST11201A5
Vector VICTR76
Project tigm

Sequence tag IST11201A5BBF1
Sequence
ATAGTAAAGTGTTTTAAAGTTGGGCATGGTGGTACATGACTTTAATCCCAGCCCTTGGAAAACAGATGCAGGCATATCTC
TCTGAGCTCCAGGCTGAGACTCTGTCAAAATGGGTGTTGGTGCTGGANAGCTGGCTGCTCTTTCTAGAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31361

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87443758..87443912 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST11201A5HMR1
Sequence
CTATAACCNAGGCAGCCTTGAACTTGTTAGGTACTTGAGGCTGACCTTGAATTCCTCCCAAGTGCTGGGATAGCAGGCAT
CANCCACAATATCCANACTCACTTTTTATTTTAAAATGGGGTCCCACTAAGTTGCTTAGGCTGGCCTTGACTTCTCTGTG
TAGTATAGAAAGCCATGACTTCTTAGTCTCTGGGATGACAGGCCTGTACCACCTGGCCTGACCAGTGTCAGCCTTTTTAT
CCCCACATACCCTTANCCAGGCTCCATCCCANTCCTCACTGTGGGCCCTCTCTTTGGATCCCATTCTATACTCGGACCTG
GCATTGTGTCTCTCCCTACCCCCAACTCACTGTCAAAGTANCTGGTGTCANCTTCTGACTCTAGGTGGGGGATGAACTCC
GCCTTCTGCCGCAGTANCNNTGTCNANTCNAGGTCTCGGAANAAACNATGCTGCTTCACCTNAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87443909..87444374 434
 
EST/CDNA Est Name
  AI527494.1 - CF553494.1 - AW475501.1 - DV048245.1 - BQ550619.1 - BE629200.1 - CJ186261.1 - CJ182343.1 - CJ181195.1 - CJ185048.1 - BM943862.1 - CX216623.1 - BQ044854.1 - BQ745199.1 - CN716245.1 - CN720312.1 - BM944096.1 - BM944214.1 - CV563362.1 - BU613350


Sequence tag IST11201A5HMF1
Sequence
ATAGTAAAGTGTTTNAAAGTTGGGCATGGTGGTACATGACTTTAATCCCAGCCCTTGGAAAACAGATGCAGGCATATCTC
TCTGAGCTCCAGGCTGAGACTCTGTCAAAATGGGTGTTGGTGCTGGANAGCTGGCTGCTCTTTCTAGAAGATCTGGTTTC
ATTTCCTANCATTCACCTTCTNANTCNCAAACACNGTTCTAGAGGACCCAACACTCACTCCNNANCNTNATGGACATGCG
GCATGANAGTGGCACANANTNNCNCACAGGCAGAACATGCACACACTTTAAAACAATATANNNNTNNCAAANGCCGTAAA
GAANGTTNAGTTCANGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene AI527494.1 - CF553494.1 - AW475501.1 - DV048245.1 - BQ550619.1 - BE629200.1 - CJ186261.1 - CJ182343.1 - CJ181195.1 - CJ185048.1 - BM943862.1 - CX216623.1 - BQ044854.1 - BQ745199.1 - CN716245.1 - CN720312.1 - BM944096.1 - BM944214.1 - CV563362.1 - BU613350


For any suggestions or comments, please send an email to unitrap@crg.es