Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10897A7
Clone ID IST10897A7
Vector VICTR76
Project tigm

Sequence tag IST10897A7HMR1
Sequence
NANTAGCTGCTGGCACTTTTNAGCCCGACCAGGGTCTTTATCCCGCCATGGACATTTTTTCCCTCTTCCCTCATTGGAAN
CGTGGTN
Sequence Type genomic DNA
Unitrap ID UNI31362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56444134..56444216 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]


Sequence tag IST10897A7HMF1
Sequence
CTCATTCATTCATTCATTCATTCATTCATTCATTCATTCCACGTAGTCTTAAGTCCCAGTAACTGGAACTCGCCAACTCC
GAAGCGGACTGGAACCTNTNAAGTCCNAGGAGGGANAACTCGGTCACAGAAGGCANGGGCCCCCGCNCACNCACACACAC
ACACACACACACACACNNNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443958..56444133 162
NO GENE  


Sequence tag IST10897A7BBF1
Sequence
CTCATTCATTCATTCATTCATTCATTCATTCATTCATTCCACGTAGTCTTAAGTCCCAGTAACTGGAACTCGCCAACTCC
GAAGCGGACTGGAACCTCTCAAGTCCCAGGAGGGAGAACTCGGTCACAGAAGGCANGGGCCCCCGCGCACGC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443982..56444133 150
NO GENE  

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es