Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606B9
Clone ID IST13606B9
Vector VICTR74
Project tigm

Sequence tag IST13606B9BBF1
Sequence
TATGCAACAGTTTTCTGGGAAAGTCTGGCCACCTTTGGTAGCTACCTTGCATCTCTGCAGTCAGCCCTCTTGAAGGTCCT
GTCTTCACCTACAGGATCATAGTTAAGCCCCACTGACAGGGTAATTACCATAGTCCAGTGTTCAGGGAACAATGGTCCTC
ANTACACTTGGGCAAAGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31359

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108198548..108198730 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]


Sequence tag IST13606B9HMR1
Sequence
CATATACTCGTGTCCAATTTTCCAGATCTGAGACACCTTGCAGCACGGCTTAATAATACTGCCCGGGGACGAAGCCAGGA
AGGACTAGAGGGAAACAATCTGATCACAGGAAAGAGCAGTAGTCTTCCTCATTTAGTGGTTGCTCTGGGGTAATGGAGGG
CCTCAGCCTCAATGAGTGTCAGTGAGACGTTGGCTTGGACGCACTCCCCCAGGGCTCTCTCAGCACCCTGAGCATGACGG
GCAGAAGCAACTGAGAGAAGGGACAGGGATCGTTGGATGTACTTCATGCTGAATCTGATGACAAATAGTCCGAAGGGAGG
ACTCGTGCTCTGGCCCCAGCTGTGCCAACAGCACCTACCCNNAACTGACACAGAACACTTTTCAGGAGCANTTGTAGGNN
NNNAAGCNCTCANNCTCCCNNAAGTCTCATCNTNNCCTCCCAGGCTGGAANCANACAATTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108198091..108198551 425
 
EST/CDNA Est Name
  BQ175512.1 - CO039119.1 - BQ174781.1 - CD776138.1 - AI844860.1 - BE954972.1 - AW319686.1 - AW125418.1 - CA887028.1 - CA887071.1 - AW611453.1 - AI463519.1 - AW122556.1 - AW124572.1 - BG074038.2 - AI844745.1 - CB177717.1 - AA958799.1


Sequence tag IST13606B9HMF1
Sequence
TATGCAACAGTTTTCTGGGAAAGTCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BQ175512.1 - CO039119.1 - BQ174781.1 - CD776138.1 - AI844860.1 - BE954972.1 - AW319686.1 - AW125418.1 - CA887028.1 - CA887071.1 - AW611453.1 - AI463519.1 - AW122556.1 - AW124572.1 - BG074038.2 - AI844745.1 - CB177717.1 - AA958799.1


For any suggestions or comments, please send an email to unitrap@crg.es