Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P137G12
Clone ID P137G12
Vector ROSAbetageo0
Project ggtc

Sequence tag P137G12
Sequence
TGCTGTTCACTGCTGATCCGTACCTGGAGCTCCACAACGATGACACACGAGTTGTGAGAGTGAAGGTTATAGCTGGCATA
GGCCTGGCCAAGAAAGACATCTTGGGAGCCAGTGATCCTTACGTAAGAGTGACATTGTATGACCCGATGAGTGGAATCCT
TACCAGCGTGCAGACAAAAACTATCAAAAAGTCTTTGAATCCAAAATGGAATGAAGAAATACTGTTCAGG
Sequence Type mRNA
Unitrap ID UNI1215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72517886..72525338 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 5SP137G12
Sequence
GTTTCTGTTCTTTAAATCAGACATTTTTGTGAACCNNNAGTATCAGAAAATGTCACTTAATGCGATTTCTCCTATCTCTC
CTGGATATCAGTACTTTCTAAATAGGTAGGAGAGACCCTAATAGATCCCTGAAAGGAAATATCTGGTGTTTGGACAATGG
ATTTTTCTTACTCCTCCATTTCTGTGTGTATGAGAACACGTGCACATGTCCTGTGTTTGCAGACCAAAGGACAACTTTGA
TCATTGAAATGTAGGTGCTTAGGGTGAGGAGAGAAAGGCAGGGCTTTAGTGTAAGTACTTACATATGCATGTAGACTCTA
GTGTA
Sequence Type genomic DNA
Unitrap ID UNI1215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72531041..72531365 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 3SP137G12
Sequence
CGATAAGACCATTTTTAAAAAATGTATTAATTCTTGATAGGT
Sequence Type genomic DNA
Unitrap ID UNI1215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72531830..72531871 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es