Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P137H08
Clone ID P137H08
Vector ROSAbetageo0
Project ggtc

Sequence tag P137H08
Sequence
TGAGTGAGTCTCTGCTGTCCGGAATTCTCTGGTTTTCTTCGCAGGCAGTGTTCTGCCCACTGGCCCACCACCTCAGGGGA
ACGATGGCCACAGAGTCTACAGGCGCTGCTGCCATCGCCGCGGAGCTGGTTTCCGCTGACAA
Sequence Type mRNA
Unitrap ID UNI1110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116299937..116300078 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 5SP137H08
Sequence
TGTATAAACAAACTTTACAGAGATTTTCATGTATTCATTTGTGTTCAGTTACACTTTGGCTGTTGGTGAAGTAATTACCA
GCTTCCTTCCTGAATGGGTATTTACAGAAAATTACATGCCTACTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116297752..116297880 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SP137H08
Sequence
ATAGCAAATGCCTATACCAGCCTCTTGCTGTTCAATTTG
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116297405..116297443 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es