Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14766E3
Clone ID IST14766E3
Vector VICTR76
Project tigm

Sequence tag IST14766E3BBF1
Sequence
GTAACTACATCTTGGTGCCTGCCAGCTCAACAGCTTGGCAGCCTGATGTGTAGGCCCTACCCTGGCAGTGCCAGCCTTGT
TAGGAAAGGTACAAAGAGAATATATGAGCCAGTGGGGGCTTGAGTCAAGTTTTCCAACCAGCTGAGAGCAGAGGGTTGCA
GTCCAGGCAGGAGAGTTCGGGAGGAAGGGCGGTGCCCTGGGAAGGTGCCTTTGTGGCCCTGCTAAGTGAGGGTGCCTTGT
ACTTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73018271..73018520 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]


Sequence tag IST14766E3HMF1
Sequence
GTAACTACATCTTGGTGCCTGCCAGCTCAACAGCTTGGCAGCCTGATGTGTAGGCCCTACCCTGGCAGTGCCAGCCTTGT
TAGGAAAGGTACAAAGAGAATATATGAGCCAGTGGGGGCTTGAGTCAAGTTTTCCAACCAGCTGAGAGCAGAGGGTTGCA
GTCCAGGCAGGAGAGTTCGGGAGGAAGGGCGGTGCCCTGGGAAGGTGCCTTTGTGGCCNTGCTAANTGANGGTGCCNTGT
NCTTGNGANCCTN
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73018271..73018522 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es