Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11698C5
Clone ID IST11698C5
Vector VICTR76
Project tigm

Sequence tag IST11698C5HMR1
Sequence
GACAGTTTAATTCTTCTCTGATCCCTCTGCGTGTGTGGCTTTTGTTTTCCTTTCCTCTGTTGTTGGGGACCAGCTGGTTT
GTGAACCCTGTGTCCCTTGCAAGGAATTTCCGAGTCTGGTAGGACAAANNGCTATGANGTTNANTTGGTTGN
Sequence Type genomic DNA
Unitrap ID UNI13159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22418503..22418653 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST11698C5BBF1
Sequence
CTGTCNTACTTNACAGATAAGTANATGAGCACACAGACAATATAAACACACNNAGAACAAAGTGTGAGGGGCTCACCAGG
CAGGGTCATTTGTTACGAGCTGAATATACAGAAAGAACCGTTTCTGCATCCAGCATCCAAAAGTAATATGGAATATGAAA
TAANAAAATATACTTAGGGGGCTGGGGAGAGACANCTCTGCTGTTAGGAACACTTGTCCCTTCCTCCTGCANAGGACCTG
GGTTTGATTCCCANCACCCACATGGTGGTTCACAATCCTNTGTAACTTCAGCTTCACTGGATCTNNNACCCTNTTCTGCC
CTTCGNGGGCNCCNAGCACACNTGTGGTATGCATATATACNGGCNANTAAAATGTACACAAAAAGGAATAAAATTAATTT
AAAAAGTAAAGAAAATATATTTTGGGCCNNTGANNNAGCTCACTGGGCCGGACAGTGGTGGCGCACACCTTTAATNNCAG
CACTTGGNANNNANNNGCNNGTGGATTTCTGANTTCNAGNNNNNCCTGGTCTATNNNGTGNNTTNCAGGACAGCTNGGGC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es