Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14193F9
Clone ID IST14193F9
Vector VICTR74
Project tigm

Sequence tag IST14193F9HMR1
Sequence
AACATTTCTGGTATTACATTTCACAACCTTTCTTTTTCCCAAAGAGCCACCTTTTCGAATTTCTTTTTTCCTTCCTTCCT
AAAAAGAAATTCTGTTAAAGCATCGAGGAAAGGAATGTCCTCTTTTCCTCCCTGCTGAGTGCTGGGGCTGCCGTGCATGT
TGCGAGCCACGCCCTCCAGGGCAGTATTGGGTGTCTGGTTCTTTATCTCTTTCCCCAGCTTTTTCAAAGTCAAGTCTTTG
ACAGTTTCTTCATATACTTTTCATTTTTTATTTTAAGTCCTGGGTGGAGTTTCTAGACAGAGTTTATAAGCCTTTTGTCC
TGCTGTCCTACCGTGACTTGGGTACAGCAGGGCTCATTTTCTGCTGGGTGTGGATTCTCATTANTGCNNGGNCNTCNGAT
TGNNNGGGAGGGCCTCTTCCACNTGTCTNTTTNNCCACACGTCNTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36056731..36057178 419
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


Sequence tag IST14193F9HMF2
Sequence
GAGACCAGCAGGAGGCTGCAGAGTGGATACTTCTCTAGGCCTCGGTTTTCTCATGGTTTGGATTAAATGTGACCTCTTAG
GATGCCCCTGGCCCTAGCAGTCCTTAAGCTGCAGTTACACTTCTTCTGGTCATGGTCTACTGTGTTTTTCCATCCCAGGT
ATGCTGGATAGCTTTATGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 36870196..36870375 180
 
EST/CDNA Est Name
  AV221454.1


Sequence tag IST14193F9BBF1
Sequence
TGTTTTGCTTACCAGAAACCGTAGCTTGACTCCCCCTGCCTCGAGTTTAAACTGCAGCCTCCTTTCCTAAAGATTCACTT
CTCATCCTAGTGCCAACATACAGGAACTAAGCAACTGCAGGTGATGGCACTGAGCACAAAGAGTTTATCCCCAAACTGAG
AGGTGAGAATAAGGATGGTTTACAAGAAAGTCCTACCAGTACCCACCCTTTCCCCAGACTGTTACAAAGCAACCAATACC
CAGGTAGTGTAAGGACCCTTCCTGAACAGCATGGCACACTGCAGTTCCCTCAGGCCCTGCGTCTTGCCCAAGTCTCTCTA
AAGCAGTCGGGGTTGAGCTTTTTTCCNCCCCTGTCCACTGAAGCACGGAATANGTCCNAGCAGTTGTGATGAGTGGAAGG
TGAAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36056328..36056734 401
 
EST/CDNA Est Name
  BY444918.1 - BF143046.1 - BE981920.1

 
Come back to gene BY444918.1 - BF143046.1 - BE981920.1


For any suggestions or comments, please send an email to unitrap@crg.es