Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145C06
Clone ID P145C06
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145C06
Sequence
TCACACAAAGCAAAACAAACNNACGAACCTNNGACTACAANNNNAACCCANNANNANNNNCACACAAACCGGCCCCCTNN
ANAACCCCCNNANNCCACCNNAACAAAACNNCACCCACAACACAANNNNCNNTCCNNNCAAANNAAACACCATAACACTA
NNCGCNNACACACGCNAACCCANNACCANNCACAACAGCCNNCNNCCAACGAACNNAAACCACCCAACCACACCCCAAAN
NAACTCCNACNNAAANNNAANNTGANNCCAAGTCGCACANNANNNACTGATGACNNATTTNANNCAACTNNNNGGCCCCN
NAATTCAGCCCCATTCCCTGTANNCTCCNCACCATGGATGGAGTNNTCACTGTGANNNCCAGAAGTATGGATGCAGAGAN
NTACGTGGATGGTCAGCGCATCTCAGANNNCACAATGCTGCAGAGTGGCATGAGACTGCAGTTTGGCACCTCGCATGTGT
TTAAGTTTGTGGACCACATCCAGGACCACGTTCTTTCCAAGAGATCTGTGGATGGAGGCCTGATGGTCAAGGGCCCAAGA
CATAAACCTGGAGCTGTTCAGGAGACAACCTTTGAATTGGGAGGAGATGTCCACAGTGGGACAGCATTGCCGGCAAGCAG
GAGCACTACTAGACTGGACAGTGACAGGGTGTCCTCTGCCTCTAGCACAGCTGAGCGAGGGATGGTGAAGCCGATGATCC
GACTGGACCAGGAGCAGGAATATCGACGACGAGAAAACAGGACTCAGGATGCTACTGGGCCTGAACTGATACTGCCTGCC
AGCATTGAATTCAGGGAAAGCT
Sequence Type mRNA
Unitrap ID UNI10975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13966883..13983340 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]


SPLK-Sequence tag 5SP145C06
Sequence
CTGAGAGGCTGTTCTTCTTTTTCCCCCTGCAAAACTCCATGTGGATTCAAACTAGCTTAAAGGGGCCCCCAGCAATGAGG
AGAGGTGGGGTCAGCTCCTTAGGCAGGTTCAATGATTTCAGGTTTTTTTTTTTCAGGACTCAGGATGCTACTGGGCCTGA
ACTGATACTGCCTGCCAGCATTGAATTCAGGGAAAGCTGTAAGTGATTTTAGATTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP145C06
Sequence
TCTTGCTCCATTTTCTCCAGGTGACTTGCATACTTTATGTTCATTTTTTTTTCTTGTTTTACAGCTGAAGACTCTTTTTT
ATCTCCCATTATAAACTATACCAATAGTTCTACAGTTCATTTTAAGTTGTCACCTACATATGTGTTATACATGGCATGCC
GGAATGTATTGTCCAGCCAGCACAGGCCCGACATCAGTCCTACAGAGCGTACACATAAGGCCATTGCTGTTGTCAACAAG
ATGGTGAGCATGAGGGAAGGGGCCATCCAGGTGAGTGGCAGCCCAGCAAGTGCTGGGAGGATGGCAGCCATCTTGTTAGT
TTCTGTCCCACTCCTGATCTGGGGACAAGTTTTGCCTGTACAGCCTGGGGGGG
Sequence Type genomic DNA
Unitrap ID UNI10975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13983377..13983749 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]

 
Come back to gene ENSMUSG00000068036


For any suggestions or comments, please send an email to unitrap@crg.es