Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13652B2
Clone ID IST13652B2
Vector VICTR74
Project tigm

Sequence tag IST13652B2BBF1
Sequence
GGAGAACGGCTTTGGCCTGGACGGGACACAGCTGAGTGAGATGCCGCGCCTGGTGCCCCGCGGGCCCGCCTCACTGAGCA
GCGTCACGCTGGGCCCTGCTGCACCACCGCCTCCGGCCACGCCGTCCTGGAGCTGCACACTGGGCAGGCTGGTGTCACCC
GGCCCGTGCCCACGGCCGTACCTGGTCATCACAGAGCAGCCAAAGCAGCGTGGCATGCGCTTCCGCTACNAGTGCGAGGG
CCGCTCGGCCGGCAGCATCCTCGGGGAGAGCANCACCGAAGCCAGCAAGACCCTGCCCGCCATCGAGGTGCGTGTTGTGC
TGCTGTGCTCTTGCTGTGGTGCCCGGGAATAGGATTGCTGGGCTTCCAACCATCTGCNAACCTCAAAAGGGCCTGGNNTG
GTGGCTCACACTTATAAAACNNANACTGGGGGACAGGATGATNNANGGGCCATCCTGGATTACAGACTGTGGCNCTTTAA
NNTAANNNANAN
Sequence Type genomic DNA
Unitrap ID UNI31379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20204685..20205169 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es