Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P146E04
Clone ID P146E04
Vector FlipROSAbetageo
Project ggtc

Sequence tag P146E04
Sequence
GAGCGACGAGAGGTTGCGAGCTCGGGCTAGAGGAGGCGCGGGCCGGGGGAAGCGGCGGGCTTTCCGCATTCACAAGGTTC
GGAGGGCCGCAGCGATCGCCGGCGAAGGGGGTCGGAGGCCCCTTCCCGGTCCCTGCACCATGAGCTGGGGCACTGAGCTC
TGG
Sequence Type mRNA
Unitrap ID UNI745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30997299..30997461 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


SPLK-Sequence tag 3SP146E04
Sequence
GTGTGTGTGTATGGGAACATGTGTTTATGAAACTGCACACCCATATGAACACA
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30973115..30973167 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es