Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145E03
Clone ID P145E03
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145E03
Sequence
CAGCGCAGCTGTGCCACAGCCGCGAGGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCCGTGTCCTCG
Sequence Type mRNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 65887200..65887271 72
 
EST/CDNA Est Name
  AK169767.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062585..30062656 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13380245..13380316 72
NO GENE  


SPLK-Sequence tag 5SP145E03
Sequence
GACCTTTTCAGGCATTGTGAATAAATGCCATTGATTCTGGCTT
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30065696..30065738 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SP145E03
Sequence
ACTGCTNNNCTGTNNNNNATNNNATAATAGTATTAAATGCTAGGGTCTTCAGAAANNNTCCTTTATGAAACACGTGATTT
TTGTCCCCTGTAAAATTTTGTATTTTTGGGGGGAAAGGGGATGATATTGAACCTGAAAAAAGTTGCATGTGAGGTATAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es