Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P141B02
Clone ID P141B02
Vector ROSAbetageo0
Project ggtc

Sequence tag P141B02
Sequence
CCCAATATAAGAANGACCCNNTGGGNNGNNNNTCCCCTGCAGACGTNNNNAATCACTNNNANCAGCAGNNNNCTNCTCCA
GAGATTCNNNGAGNAANNNCGATTCTTTCAGAAGNNAGCTCAAGAAGCAGACTGACATTCCAAACAAATTTGAAATGAAG
CTTCGCCGCGCAAACATTCTGGAGGATTCTTACCGGAGGATTATGGGTGTGAAGAGAGCTGACTTGCTCAAGGCCAGACT
CTGGATTGAGTTTGATGGTGAAAAGGGCCTTGACTATGGAGGGGTTGCCAGAGAGTGGTTCTTCCTCATCTCGAAGGAAA
TGTTCAACCCTTACTACGGCCTGTTTGAATATTCTGCTACGGATAATTACACCCTACAGATAAATCCTAACTCGGGCTTG
TGTAATGAAGATCACCTCTCATACTTCAAGTTCATTGGCCGTGTGGCTGGGATGGCAGTTTATCATGGCAAGCTGTTGGA
TGGGTTTTTCATCCGTCCGTTTTACAAGATGATGCTTCAGAAACTGATAACACTGCACGACATGGAGTCCGTGGATAGTG
AATATTACAGTTCTCTGCGATGGATTCTTGAAAATGACCCGACGGAGCTGGACCTGAGATTTATCATAGATGAAGAACTT
TTTGGACAG
Sequence Type mRNA
Unitrap ID UNI10985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72580407..72586942 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 5SP141B02
Sequence
TTAATTGATTAATTAATTGGAGTGTAATTTTCCTTCTAGGATAGTGAATATTACAGTTCTCTGCGATGGATTCTTGAAAA
TGTCCCGACGGAGCTGGACCTGAGATTTATCATAGATGAAGAACTTTTTGGACAGGTCTGGGGGCTTTCAGATGCTAAAC
ATCCTTTGCAAAACCAACCCTGTCATCTAATTATAGGCGTCAGTACACCCTTGAGACACTTTTGGGCT
Sequence Type genomic DNA
Unitrap ID UNI10985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72586808..72587035 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 3SP141B02
Sequence
AGCAAAAGCTGTCTCTCAGCCAGCATTTGTATCTGTGCTGACACATGACCACATTCTGTGTTTGTCTGAGTAAAACTTAT
GTTTAAGGCACCTTAGCTTTTCACTTTTGAGTGGAATTNNANTCTAACACCAGGTTTCTGGTGAAAATCATGTGCGCTTT
TCTCCCATTTCCCTTACAAAAACCACATTCATGTTTACTTTAGACACATCAGCACGAGCTGAAAACCGGAGGATCAGAGA
TTGTTGTCACCAATAAGAACAAAAAGGAGTATATCTAGTGAGTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es