Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10902G8
Clone ID IST10902G8
Vector VICTR76
Project tigm

Sequence tag IST10902G8BBF1
Sequence
GGGAGGATTAGTGTGGGTAGTTTAACTTCTGATTCTTATCTTTTACAGTACTTAATGTGGCNNANAATCTTGTAGTAGCC
GGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCNGCCTGGT
CTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACNNANAAACCCTGTCTCGAAAAAAAAAAAANAN

Sequence Type genomic DNA
Unitrap ID UNI9435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32409126..32409349 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es