Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14630F10
Clone ID IST14630F10
Vector VICTR74
Project tigm

Sequence tag IST14630F10HMR1
Sequence
TTAATTGAACTCAGGAACACTGGAAGAGCAGTCAGTGCTCTTAACCGCTGAGCCATCTCTCCAGCCATATATAAAGATGG
CGTCTGGCTGGCCTCCAGCTCTGGGACTAAGGATAAGCATAACCAGGAACTTCCATGAACCTCTATCTCCCGAATATTAA
GATGAGGGTCCTATTTACAGAGTGCCAGTGATTAATCCCANAGTCTTATGCTTACTAAGTGAAAACTATCAACTCNNCTG
TGCTCTCANCCTCCCCTTTCCTGTCTCCTATANGTCAGGCTGGCCCCATACTATGTANCNNNNGGTCTCNAACTTTTTTT
TTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130386272..130386594 301
NO GENE  


Sequence tag IST14630F10BBF1
Sequence
TTATCAGCAACCACATGGTGCCTCACAACCATCTGTAATAGGATGCCCTCTTCTGGTGTGTCTGAAGACAGCAAGTGTAC
TCATATATAAAATAAACAAATTCTATATAAATATATATGTGTAGATATAAACAAAACAACCTACTAGTGACTATGACCTC
TTTTCCTTTCACTCAGGAACCTGAGACAGGAGGATCTTGAGTTGGAGTCCTGCCTGGGCATTATTGTGAGTTTCAGAATC
TCACGAGCAAGAGTGAACCACCTCATCTCCAGANGAGAGAAAACAAACCCCTTCTAGTGTCTAGTGCTCTTCCTACGACT
TGGGGGAAATCACTGATTTTTGTCTCCATCTTATTTCCTACAGGAAACCTGAAAGACCTGTTAAAAACTCTTTTCCAGCT
GTAACCAAGATCCTCCGTGCTGGTCACCTGGNCTTTTTGACN
Sequence Type genomic DNA
Unitrap ID UNI29270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130386592..130387032 437
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025535 (4930579G22Rik) RIKEN cDNA 4930579G22 gene Gene [Source:MGI Symbol;Acc:MGI:1923099]

 
Come back to gene ENSMUSG00000025535


For any suggestions or comments, please send an email to unitrap@crg.es