Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12362H9
Clone ID IST12362H9
Vector VICTR76
Project tigm

Sequence tag IST12362H9HMF1
Sequence
CCACGATGTTCTGAGACGAACAGCAGGGCAGGATTTCACCAAATAGGCAGGGAGGATGTTTTGTTTCAACCCAGACACAG
ACAGATTCCAAACCTCCCCCAGACAGGGCCAGGGCCTTGCGTCTGAGCCTCCTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI21804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58143733..58143870 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]


Sequence tag IST12362H9BBF1
Sequence
CCACGATGTTCTGAGACGAACAGCAGGGCAGGATTTCACCAAATAGGCAGGGAGGATGTTTTGTTTCAACCCAGACACAG
ACAGATTCCAAACCTCCCCCAGACAGGGCCAGGGCCTTGCGTCTGAGCCTCCTGCTGGCCAGACATATTCTCGGAGAGAA
CTAATCCCCACAATGGGCCACCTCTAGCCTCTGGCCTTACAACCCATCCCCAAATGAGGCCAGCCAGGACAGCTGTCAGC
GGTCAGCTGCAAAAAGGAGAGCTGGCAGCCAGGCTTCCTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTNTNTC
Sequence Type genomic DNA
Unitrap ID UNI21804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58143549..58143870 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es