Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14714H3
Clone ID IST14714H3
Vector VICTR76
Project tigm

Sequence tag IST14714H3HMF1
Sequence
CCGCAAAATAATGTTTTTAGTGATTGTATGTTCTTGGCTTCCTTTCTAAGTTCTGACTCAACAGCCCTACTGTTCCTCTG
GCCCAGTGGGGTGGTTGTATTTGGGCATGATCTTTGTGTGCCAGTCAGCTGCAGGATCGGGGCTTTTGCATATTGTACCT
AAATAGCTTCTGTGAATGTAGTTGTTCTGGGAGGCAGTTAAATGTTGAGATGGTATTTTCGGATCTCTTTAAAGAATATT
ACAATGCCGAGGAAGAAAATAGCTTGTTTGAAGCTTGTTACTCATGAGCCCCTGACATGGAGACAGGAGCCAGTGGTTTG
AGCCCACTGGCTCTGCCTTCACTGACTTCCTTTTGAGTCANCANCTACAGGCCCTGATTGTACCATCAGGGGAAGGGGAG
GGGCANACCAAGCCACCATCTCTGCCATGTGTCAATGCTGCTGCTGCTTCGTCCTCCTCCTCCTCNTCCTCTTCCTCTTC
TTCTTCTTTCTTCTATGANTTATTTGATATATGTGANTNCAGTGTCNNTGTCTTCAN
Sequence Type genomic DNA
Unitrap ID UNI13032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45834357..45834892 518
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034135 (BC033915) NP_081774 Serine/threonine-protein kinase QSK (EC 2.7.11.1)(Salt-inducible kinase 3)(SIK-3)(SIK3) [Source:UniProtKB/Swiss-Prot;Acc:Q6P4S6]


Sequence tag IST14714H3BBF1
Sequence
CCGCAAAATAATGTTTTTAGTGATTGTATGTTCTTGGCTTCCTTTCTAAGTTCTGACTCAACAGCCCTACTGTTCCTCTG
GCCCAGTGGGGTGGTTGTATTTGGGCATGATCTTTGTGTGCCAGTCAGCTGCAGGATCGGGGCTTTTGCATATTGTACCT
AAATAGCTTCTGTGAATGTAGTTGTTCTGGGAGGCAGTTAAATGTTGAGATGGTATTTTCGGATCTCTTTAAAGAATATT
ACAATGCCGAGGAAGAAAATAGCTTGTTTGAAGCTTGTTACTCATGAGCCCCTGACATGGAGACAGGAGCCAGTGGTTTG
AGCCCACTGGCTCTGCCTTCACTGACTTCCTTTTGAGTCNNCANCTACANGCCCNGN
Sequence Type genomic DNA
Unitrap ID UNI13032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45834357..45834730 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034135 (BC033915) NP_081774 Serine/threonine-protein kinase QSK (EC 2.7.11.1)(Salt-inducible kinase 3)(SIK-3)(SIK3) [Source:UniProtKB/Swiss-Prot;Acc:Q6P4S6]

 
Come back to gene ENSMUSG00000034135


For any suggestions or comments, please send an email to unitrap@crg.es