Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14554E3
Clone ID IST14554E3
Vector VICTR74
Project tigm

Sequence tag IST14554E3HMR1
Sequence
TTATAAATAAGTACACTGTAGCTGTCTTCAGACACACCANAANAGGGCATCANATCTCATTTTGGGTGGTTGTGAGCCAC
CATGTGGTTGCTGGGATTTGAACTCAGGACCCCCGGAAGAGCAGTCAGTGCTCTTAACCTCTGAGCCATCTCACCAGCCC
GTGTCTACACGTCTTATAAATGAGTCTAAATAAGTCCTGGTGTATTTAAACAGCTGANAGCCTGTAAGTGAAAGTTTTTG
AACCCTTTAAAAAAAAAANCCNCAAACC
Sequence Type genomic DNA
Unitrap ID UNI18231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114394108..114394374 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]

 
Come back to gene ENSMUSG00000031953


For any suggestions or comments, please send an email to unitrap@crg.es