Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10909C10
Clone ID IST10909C10
Vector VICTR76
Project tigm

Sequence tag IST10909C10HMF1
Sequence
ACATGGTAGCTCTGTGTACTGTCAGCAGCCGCCACTGACTTGGGCAGCTCATATTTTGCAGCAGGTGACAGGCTGTCA
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55706555..55706631 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST10909C10HMR1
Sequence
GTCCCCTCCCTTCACCCCCTTCTGCTGCCAGNCTTGCCCCANNGCTCCTTGCTCTCTCTCTCCCTTGTCTTTTCTGCTAG
CTTTCTGAACTCATGAGAGTCTTTTGGTTCTTTATTACAAGATCAGGCTAGGCCGTAAGCCCTGGTTGGCACACCTTTCT
CCTCTGAGGTTTATTTCTGCAGATTTGCTCTGAGACTCATAGTGAGCTCTGTATCTCAGGTCTCANGAATTTTTTTTCCC
CCAACAGTGGGCAGTCAATGTGAAGGTCATTTCCAACAGGGTTGTTTACACCACAGTTTGGGCANCANCTAACTCCTATC
TCTTGCTCTGTGACCCACTCAGCCGAGGCTCACGTCACTGCGATCCCTTTANACGGGTGTTTANGATGGGTCTCATGTNC
ATTTANGAACTTNNGNGGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55706630..55707049 394
 
EST/CDNA Est Name
  CJ128585.1 - CJ127306.1 - CJ129471.1 - CJ129634.1 - CJ127815.1 - CJ130506.1

 
Come back to gene CJ128585.1 - CJ127306.1 - CJ129471.1 - CJ129634.1 - CJ127815.1 - CJ130506.1


For any suggestions or comments, please send an email to unitrap@crg.es