Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10987A12
Clone ID IST10987A12
Vector VICTR76
Project tigm

Sequence tag IST10987A12HMR1
Sequence
ATACAAGATGCAGATTTTTAGGAACCTTTTATTTTTATGTGGTGTGTGTGTTTTAACTAAATCCTAAGTGCACTGAGCTC
AGCAGTACTTGTAGAGGTCANAAGAGGGCGCCAGACCCCTTGGAATGGGAGTTACAAACTGTTCTGAGCCCAGATGACTG
AAGTGCCTCTCCTGCCATTGCAGTTTGATTCANCCACAACGATGAGTAAAATTATACCNNTTATGAGAAAGTGGATGGAA
CTGGACATCATCATGTTAAGTGATATAACAGACNANTN
Sequence Type genomic DNA
Unitrap ID UNI31406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133836785..133837057 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059772 (Giyd2) NM_029420 GIY-YIG domain containing 2 Gene [Source:MGI (curated);Acc:Giyd2-001]


Sequence tag IST10987A12HMF1
Sequence
NTATATGTCCCATTTTCTTCACCCACTCATNTGNNGATGGCACTGTGCTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000059772


For any suggestions or comments, please send an email to unitrap@crg.es