Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10835G4
Clone ID IST10835G4
Vector VICTR76
Project tigm

Sequence tag IST10835G4HMR1
Sequence
GTACCTGTCTTTGTGCCCGGCATTAGCTTGAGCTGTGACTAGGTCAAGTATGGTCCTCTTTTTGAAACACTGAGCTGAGG
ATGGTGAGTGTATGTGCAACAGTAAACTTTAAAGAGCTAGGATGTGAGAGGGGTGTTTGTTAGTGGGCTTGTGCGCAGTG
TCCGCTCAGCTCTTTCTGGGATAGGTGTGACTAGTTTAGTTCCTTTGCCGCTGAGTTCTTTGGGCTGGACTTGCATGCTC
CTCTGTGGAAAGGGNNNNGGGCTGANTNGANNNGNGNTNANANGGANTN
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126142384..126142653 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


Sequence tag IST10835G4BBF1
Sequence
CTTAGTATACCCATATGAAATGAATGACNAAGTCTACCCATANGCACACCACANNAGTACACAACTACACAACCACACTC
GCAACGGTCCCGAACGAACAATCATAAACTCTGCATTGGAGAAGCACTTGCCCCCTTTCGGATAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126142653..126142801 141
NO GENE  

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es