Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14190H6
Clone ID IST14190H6
Vector VICTR74
Project tigm

Sequence tag IST14190H6HMR1
Sequence
CCTAACCTTTCGGGGCCTGACCTCCAGCCATCTTTGATTTCCGACTATCTAAAAATAACCGCGGCCAGCGGGAGGGTGCG
GGCCGGGGCCCGGGCAGCGGGTGCATGGTCNNNCNNACNGGNNNNTNNTGNNTCTNNGTNATTTATTTTTTTGCACGGAT
CCCCCGGGCGGCACTGCTCANCACACGCCCGGGAGGTGAAAGGGGAGAGGTCGGGTTGCGGCTGACCCGGCCTGANCCTC
CACGGANTTCANGACCTCNNCGCGGCCGGGANCTGCNGGCGAGCCCCTCGTCCCTGCCNNCCGTGCTGTCGCCGANNAAA
CCGGGAACGTTGGGAGGAGGN
Sequence Type genomic DNA
Unitrap ID UNI30150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168591349..168591688 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


Sequence tag IST14190H6BBF1
Sequence
TTCANTCTCTAAANTANCTTTCCTCTCTNANCGAAGTCATTCCCTGGCTCACCAGACCTCAGGACAGTCCAAATCCCTCC
ATCCAACTCCACGTCCGCTGCTGCTGACCCTGTGTTTCCAGCTCCACTTTGCCAGTTCTTTAAAAAGTCTTTACTGTAGA
TCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27982737..27982900 154
NO GENE  

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es