Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14479B10
Clone ID IST14479B10
Vector VICTR74
Project tigm

Sequence tag IST14479B10HMR1
Sequence
GTTTCTCTCCNTTTTAATCTCTCTCCTGCTCGACATCCTTTTACCCAGGTGTTCTGTGTTAAGCTGCTGTCCCAGAGGTG
CTGGGCATTATGGGAAATCANCTGGCTGGCATCGCTCCTTCCCANATCCTGTCTGTANAGAGTTATTTCTCAGACATCCA
TGACTTTGAGTATGATNAGAGCCTGGGAAGCACTCGGTTTTTTAAAGTCNCTCGANCCG
Sequence Type genomic DNA
Unitrap ID UNI26884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105546478..105546695 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032571 (Pik3r4) NM_001081309 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 Gene [Source:MGI Symbol;Acc:MGI:1922919]


Sequence tag IST14479B10BBF1
Sequence
AAACAAAGAAACAGTGAAATCGCCATTATTTGGCCTTTTCCTAAAAGACATCTGTACCTTTACCTACTATGTGTGTGAAT
GTGAGTCCCAGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105546384..105546481 98
NO GENE  


Sequence tag IST14479B10HMF1
Sequence
AAACAAAGAAACAGTGAAATCGCCATTATTTGGCCTTTTCCTAAAAGACATCTGTACCTTTACCTACTATGTGTGTGAAT
GTGAGTCCCAGATCTGTCTCAAATTCAGAAAAAATTATCTAAGTAGATTTTATTACTTTTATCTAAAAATATGGTGCTAC
GTCATGTCATTCTTTCCAGCCGCTAAACTGTTTAATTACATACATGCCTTCAACATTTTATTTTAGAGATAAGGTCTGTG
TANCCCAGGCTTGGCATGGAACTCTCTATGTAGCCCGAGAAGTGAGTTTGAACTCCANATCCTCTAGCCTCNACCTCGTA
AGGGCTGANATCCCACTATGCACAACGTAGTCCCTTCAGCATTAAGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105546114..105546481 358
NO GENE  

 
Come back to gene ENSMUSG00000032571


For any suggestions or comments, please send an email to unitrap@crg.es