Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14383A10
Clone ID IST14383A10
Vector VICTR74
Project tigm

Sequence tag IST14383A10HMF1
Sequence
AAACAAAGCAAAACAAAAGGTGAAGCCAAATGTAGTAGTACTATAATCCCAGATTTCCAAAGGATTTCTCAAACAAT
Sequence Type genomic DNA
Unitrap ID UNI30727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7816865..7816941 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST14383A10BBF1
Sequence
AAACAAAGCAAAACAAANGGTGAAGCCNAATGTANTANTACTATAATCCCANATTTCCAAAGGATTTCTNAAACAATTTT
TGCTCTANTTTTGCTTTATTTTGTTGANAAAGGGTCTNATGTANCCNAGGCTGGCCTCAAACTCACTGTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14383A10HMR1
Sequence
TTTGTTTTTGAAAAGGGCCTACNATACTGTCCACATTGGCCTTGCAGTTCTAGGCTTGAGGGTTTTCATTTTAGGCACCC
AAGTAGCTAGGACTATAGGTGGTGGTAGTACTACATCCAACTATCAGGCTTTGTGTGTGTGCTAGTGAAATTGGAACCCA
NGGCCTTATGCATACGAGGCAAGGACCTACCTACCGCATCCGCATCCTCANCCCATCACAGGACGTCTTTGAANGCACAC
CTGCNTATGCACACNANNNNNTCTGAATGATGAGGAAAGCANACTNTNCTNANNTNCNNTTATCACCTTACATTTGAATA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es