Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14100E5
Clone ID IST14100E5
Vector VICTR74
Project tigm

Sequence tag IST14100E5BBF1
Sequence
NNATCTGACTCCTGCTGCTAACTTTGGAGGAGGGTTGN
Sequence Type genomic DNA
Unitrap ID UNI24601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113445090..113445124 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031749 (St3gal2) NM_009179 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI (curated);Acc:St3gal2-001]


Sequence tag IST14100E5HMF1
Sequence
ATTCTAAGCTAATCTGACTCCTGCTGCTAACTTTGGAGGAGGGTTGCCCCTTCTGGGGGATGGTGTGGGGN
Sequence Type genomic DNA
Unitrap ID UNI24601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113445079..113445148 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031749 (St3gal2) NM_009179 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI (curated);Acc:St3gal2-001]

 
Come back to gene ENSMUSG00000031749


For any suggestions or comments, please send an email to unitrap@crg.es