Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D007B12
Clone ID D007B12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D007B12
Sequence
TCCTGATGCTGCTGCTGCTACACTACTTGATCGTCGCCCTGGTCT
Sequence Type mRNA
Unitrap ID UNI243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84774754..84774798 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


SPLK-Sequence tag 5SD007B12
Sequence
GATCTGGGCAGTTAAGAATTGAAGAAAACAGACGATCCTCATCTCCTTGCAAAGTCCGAGGAAGTTTTCAAAGACACGGG
GACGTGATCAGAATGCAAAACTCTCTAAGTATTCAAGATGCGAAGAGCCCAAGAAAGATGGCATCCGGGGTTGGCGAAGG
CCACTCTTAAGTAGCTGCGGCTGAGGGATCAGTGGTTACGGTCCCAGCTGCCCCGGGCAAGGTGCTGGGTAAAGCACTTT
AGAGGCGGTAGCGGGGTG
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84775005..84775262 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


SPLK-Sequence tag 3SD007B12
Sequence
AAAACCGGCTTAGAGAAGTCTGTCCGCTCCAGCCAGCTGCCGTGTCCTCAGGGGATGTCCAGCCAGCGGGACTGGCTGTT
AGGATTGTTAGAAAGGCGCAGGCGATGAATGAGCGAGC
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84775304..84775421 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es