Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0023
Clone ID CJ0023
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0023
Sequence
CCATCCCATCGGCCCTTTTTCTCCTCTCGCCTCTACCCTGCTTCCCAGCTAGCCTTCCTACCTCCCCTCCCGGCCTCCTC
TCATCATACTTTCACATCCACCTGTGCCATTCTTCCTTCCCGGTATTCGCCTCGCCCATGAATCCCCCTCCTCTCATTCT
CACATCCACTTCTACCCGCCTTCCGCCCTCCGCCACTGTGTCCATCCCCTGCCCGCAGAGCGCCGCTTGCCCGGGCCGCT
GTAGTCAGTTACCTGCTCCGCGGGGCGAACACGTGCGGGGGCAGACAGACACTCCAGCTTCGCAGGAGGCCGGCGCCCCT
GCACCGCAG
Sequence Type mRNA
Unitrap ID UNI1396

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 21878372..21878524 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053219 (Raet1c) NM_198193 retinoic acid early transcript 1E Gene [Source:MGI Symbol;Acc:MGI:2675273]

 
Come back to gene ENSMUSG00000053219


For any suggestions or comments, please send an email to unitrap@crg.es