Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14385C2
Clone ID IST14385C2
Vector VICTR74
Project tigm

Sequence tag IST14385C2HMR1
Sequence
TCCTGACAGCCTCAGTGCTGTGGTGAGAAAGGGGCTTGGGATGTCCTGACACTCCGTTCCCTTTCCCTCCCGCCTCCAGT
TTGACGCCGAGTTCCGACGCTTTGCACTACCCCGCACTTCGGTGAGAGGCTTTCAGGAGTTCTCGCGATTGCTGTGTGTG
GTACACCAGATCCCTGGCCTGGACGTCCTGCTTGGCTATACGGATGCTCACGGTGACTTGCTGCCCCTCACCAACGATGA
CAGTTTGCACCGGGCCC
Sequence Type genomic DNA
Unitrap ID UNI31416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108225995..108226251 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005699 (Pard6a) NM_019695 par-6 (partitioning defective 6,) homolog alpha (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927223]


Sequence tag IST14385C2HMF1
Sequence
AGGNGAGGGAAAGGTTGCTGGAACAGCTGCAGCCTTAGGCTTAAACCTCAGCTCCAGTACAAGGGACACTGTCCAAGGTC
TTTCCCTTGCTCTCCACATACCCAGGCCACAGAGGGACTCTGGAAGTCCGTAGTGGGAGGGAGGATGCGATGAGGGGAGG
CAGACAGAAAAGCAGAATAGGACGGAGGATGGAGGACAGAAAGAGGTGATGGAGAGCCNAGGAACTAATAAGGGAGAGAA
AGGGAATNNGGAGCCCTAGCNCAGTGGCTAGAGCCGAGACCAGANAANCCCTTACTTTGCTCTTCACCTCGACNATGCTA
TCGGGACTGCGCGCCGGANTCCTCTGCGGCCTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108225644..108225998 337
NO GENE  

 
Come back to gene ENSMUSG00000005699


For any suggestions or comments, please send an email to unitrap@crg.es