Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P119C09
Clone ID P119C09
Vector ROSAbetageo0
Project ggtc

Sequence tag P119C09
Sequence
AGGGCGGNNGGTGACTGGCACCGTGCCGACCCGCCAGCCCACCCGCATCGCNNANTGGTNAGCCGGGCCGGTCGCCGGGG
ACATTGTTTTAGGCNNACGACACATNNCTCCNNTGGAGGTAGGAGGCAAGAGGAGAGCAGGGCCCCCCGGGAGGNAGGGG
CAAAGGANNTTGGTGGCNNNNGTCCCCCGAGNNCTGGGAATATAGGGGACCCAAAATTTGTTTCNNAAAACTGGCTCCCT
AGGATCGGGGGCCAACGATTTGGGAGNNNCACGAAAAGAACGGCCCCGGATGAAAGCGNNCCGGTTGTTTTCCAATGAAN
NNAAACTTTACCCNNNCCAAAAAAAAGGTGGACCTCCCACCCTCCCTTGAAGGGTTCGGCTGAAATGTTTAAACCAAATT
CTTGGTGCAGCAGCCCCTGAATATCCTTCAGCCACTTGCAGTAAGCATGGGTGCAAACATCAGGCAGCATGTAAAGAACC
TGGGCATCCCTGTCATTACTGTTCTCGGAGATAGCAAGAACAATGTTCGAGCTGCTGCCCTAGCAACTGTGAATGCTTGG
GCAGAACAAACTGGCATGAAAGAATGGCTGGAGGGAGAAGATCTTTCTGAAGAACTTAAAAAGGAAAATCCCTTCCTGAG
GCAAGAG
Sequence Type mRNA
Unitrap ID UNI10990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90937217..91421395 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]


SPLK-Sequence tag 5SP119C09
Sequence
TAATTTAAGAATGATATGGTCAGTAAAGGTTAAGTGCTATTTAAGTTTGAAATTATGAAATAAAGTGTTCTTGAGGTAAG
GATTTGGTTAGAGAAATAAGATTTTTCTTTACTCCCATTAGATATGTTTTTATATTTTTTTCTATGAGTAGATTCTCAGC
TCTTTCCTGAAAGCTAGTTTTTTCTCTCATCCCTAACGTAGGGTAAGTTGTGAACTAAT
Sequence Type genomic DNA
Unitrap ID UNI10990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91423125..91423343 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]


SPLK-Sequence tag 3SP119C09
Sequence
TTTTTNNNCTGACTCCTGATTACAGGCAAAAAAAAATTGGCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es