Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14632E12
Clone ID IST14632E12
Vector VICTR74
Project tigm

Sequence tag IST14632E12HMR1
Sequence
ATCNGATTATTTGTTAATACTCATTCTTTCCTTAACTGGTCANAAACACTGAAAAGAATCTTAAGGAGCAATCAGTCCGT
TAAGGCTAAGAAATATCTCTAATATTTCACCTTAGTCCAAGTTAGTGATACAAATTTATTCTTTTTACCGAAAAAACAAT
GGGAACTTTTGGCAGCTTAATTGGTTCAAAAGATAATAGGAAATTTTTGTACCATAGCTTGTTTTTCAGTAAAAAAAATA
AGCATGGTCTANGTANTGTTTTACAGCTTATGTTANTTAATTANTACCCANNAAGTGCTCATGANATAAAAATTGCCTTT
GGAATANTGGGCTCTTTTTCTTTTTTCCTTCCTAATGAATATTTTTCTCCNAAGATAAATGANNTC
Sequence Type genomic DNA
Unitrap ID UNI15829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38779408..38779789 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]


Sequence tag IST14632E12BBF1
Sequence
AGTTCTTTAAAATGTTCCAATGAATAATTAATANCAAATGCATTGTTCTCTGGTTTTCCTTACAATAATATTCTNATGTA
NAATTGAAAGTGATGGCTGCAATAAAATCTGTCATCTGATAGTAAGCACAGGTGGGAACAGAAACTATTANCAAACAGGA
AGGCATTTCCAAAATACATTACNAGGGATACCCGATAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38779811..38780013 193
NO GENE  


Sequence tag IST14632E12HMF1
Sequence
AGTTCTTTAAAATGTTCCAATGAATANTTAATAGCAAATGCATTGTTCTCTGGTTTTCCTTACAATAATATTCTCATGTA
NAATTGAAAGTGATGGCTGCAATAAAATCTGTCATCTGATAGTAAGCACAGGTGGGAACAGAAACTATTAGCAAACAGGA
AGGCATTTCCAAAATACATTACGAGGGATACCCGATAGATCTGGAGACGGAATTTGAAAACCTGCGGGTAATCCTTACAT
CAAGAATTACAACATTTACAAATTAATACCAAACCAAATCTGTGCATAAATTTAAAACGCCAAAACCATCACCTTTGCTC
TTCTACACAGTGTCTCTTTCTACCCTAACTATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38779811..38780162 348
NO GENE  

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es