Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14208B11
Clone ID IST14208B11
Vector VICTR74
Project tigm

Sequence tag IST14208B11HMR1
Sequence
AGTTTGAGCCTTTTGCTCTGCAGAACATTCTGGAGCCTCTCGAGAAAGCCTTTTGTTTGTTTGTTTGAGTCTCGCCATAA
GTCAGTCTGGCTTCTGCTTACCAGTCAGAGGCTGGGATCCTAGGCCATGCACTGTCCTGCTAGGACACAAGCGTCCCTAT
GCAGTTGAN
Sequence Type genomic DNA
Unitrap ID UNI16553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57985675..57985842 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020514 (Mrpl22) NM_175001 mitochondrial ribosomal protein L22 Gene [Source:MGI (curated);Acc:Mrpl22-001]


Sequence tag IST14208B11BBF1
Sequence
ACTCCAGTTGCTGAGAAACAACAGCGAACGAATGTACAATGTCAGGCAAGCCTCGAGTCTCCAAACAGTCCTTGCCCACG
GCAAGTGAATAAAGAAATAACCAGGAATGTTTGTTGGTATAGCACACAAAGTCGAAGATTCGAATCGTGCCTACGGAATA
GGGAGAGGCTGGTCAGAAAACACCGAGAGGAGCCCCCGGAGGCAACAGTCTCTATGGGGTTCTGGGTCGGGCCGCCCTCC
ACCTGAGGCCGAAAGTACTGCCTGGCACACAAGTGCACTGTGATCGATGCAGATCAGGCGCAGCCTGCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57985363..57985677 315
NO GENE  


Sequence tag IST14208B11HMF1
Sequence
ACTCCAGTTGCTGAGAAACAACAGCGAACGAATGTACAATGTCAGGCAAGCCTCGAGTCTCCAAACAGTCCTTGCCCACG
GCAAGTGAATAAAGAAATAACCAGGAATGTTTGTTGGTATAGCACACAAAGTCGAAGATTCGAATCGTGCCTACGGAATA
GGGAGAGGCTGGTCAGAAAACACCGAGAGGAGCCCCCGGAGGCAACAGTCTCTATGGGGTTCTGGGTCGGGCCGCCCTCC
ACCTGAGGCCGAAAGTACTGCCTGGCACACAAGTGCACTGTGATCGATGCAGATCAGGCGCAGCCTGCAAGATCTTCGTG
GCAGGACTCTTACCGCAGCGTCTGCGTTGCCCAGATCCTCAGGTTAGGTACCCTCAGTGCACCTGCAACGTGAATACGAG
CTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57985273..57985677 405
 
EST/CDNA Est Name
  CF106262.1 - BU937513.1

 
Come back to gene CF106262.1 - BU937513.1


For any suggestions or comments, please send an email to unitrap@crg.es