Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12654A4
Clone ID IST12654A4
Vector VICTR76
Project tigm

Sequence tag IST12654A4BBF1
Sequence
CCACTAGGCACTCGCATTCCACGCCCGGCTCCACGCCAGCGAGCCGGGCTTCTTACCCATTTAAAGTTTGAGAATAGGTT
GAGATCGTTTCGGCCCCAAGACCTCTAATCATTCGCTTTACCGGATAAAACTGCGTACGTCGGGAGCGAGAGCGCCAGCT
ATCCTGAGGGAAACTTCGGAGGGAACCNNCTACTANATGGTTCGATTAGTCTTTCGCCCCTATACCCAGGTCGGACGACC
GATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCGCCCTGCCCAGGCATANTTNACCATCTT
TCGGGTCCTAACGCGTACNCTCGTGCTCCACCTCCNNGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGCGGAC
TGNNGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391268..57391690 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es