Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14699G5
Clone ID IST14699G5
Vector VICTR76
Project tigm

Sequence tag IST14699G5BBF1
Sequence
CTAGAAAGTTGGACATCGTTATGCTCGGAATGAATCAAACCTTACCTGCTTGTCTGTGTTGGCCTTAGTTGCGCGGTCCA
CGTGGCCGCTGATGCTGCTGATGCTGATTTGAGGTCCCTTATGATGTATATCCCAGGGACATGGTTGGCTTTTCAAATAG
GAATTGTCGCTATTAGCGGGGAGTCTGGGAAGTTCGCCTGTGGTAAGCCGGGTGCCACCTGCCTGTGGCTGAGTTAACTG
GATGGCCTGTTGTCCCTGCTCCCTGCTGCTGGGCTTGTTTATTGAGATTAAGGTTGGATTTGCCCTGGAGCAGGGCAGTC
ATGGGGGTATAGGCAATTATTCTAATATGAGTACTTACAGTTATTTCCTTAAAGTATGTTTTTAGGTGTGAAATTGTGGG
GCCNAGGGTCTGGANCN
Sequence Type genomic DNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114636928..114637341 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]


Sequence tag IST14699G5HMF1
Sequence
CTAGAAAGTTGGACATCGTTATGCTCGGAATGAATCAAACCTTACCTGCTTGTCTGTGTTGGCCTTAGTTGCGCGGTCCA
CGTGGCCGCTGATGCTGCTGATGCTGATTTGAGGTCCCTTATGATGTATATCCCAGGGACATGGTTGGCTTTTCAAATAG
GAATTGTCGCTATTAGCGGGGAGTCTGGGAAGTTCGCCTGTGGTAAGCCGGGTGCCACCTGCCTGTGGCTGANTTAACG
Sequence Type genomic DNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114636928..114637165 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es