Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P118F09
Clone ID P118F09
Vector ROSAbetageo0
Project ggtc

Sequence tag P118F09
Sequence
CTCTTAGAACCTNNNTGCGGTCGTGCTTGCATCTCGCTGCTGCAGCCTCCCGGGCTCCGGTCCATCCTTTCAGTCTGAGA
CCGGCCCAGAAGAAAAAAACCCCAAAAACCTTAATTTTCTTTCTTGTTCGGTACCTACATTGGAACCATCAAAAACAATT
ATTTCAGTAAACCGTAGCCATGAGGGAAATCGTGCACATCCAGGCCGGACAGTGTGGCAACCAGATCGGTGCTAAG
Sequence Type mRNA
Unitrap ID UNI10992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35974942..35975177 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001525 (Tubb5) NM_011655 tubulin, beta 5 Gene [Source:MGI (curated);Acc:Tubb5-001]


SPLK-Sequence tag 5SP118F09
Sequence
AATTCTGTGTTAATTGTGAGCATTGTTCACGGAGTTCTTGCATTCTCCACCCGTCAGATTTGGCCCCTCAAAGTTTTTCA
CGTATAAATATAACCCATATTTGTAGCTAGCGTTCTGATATTGAAAAATGAGGAAATGTTTTTCTTGGCACATTTTCGGA
AAGCTAATAAAAGAGCCTTTCGAGTTTAGGGAAAAGGAGAGGCTGAGGGACTGTGAAGAGCTGGTCTTAAAAGGGGTTTT
CTAACGGTTCGAGGACTGGAGGGATGCGGAAACGATCCGAGACAAAGCCGAGGCGAGGTTTTCCCCTTGCGCCACCCCCA
CCCAGCCTGGAGGGCTCTACTGGAACAGAATGGAGGGGGGAAGGGGCGAGGTTTGGCGGGCAGCTGCAGAGGTGCCCGGT
GCGCATTACCTCTCAACAAAGGCTTGGAC
Sequence Type genomic DNA
Unitrap ID UNI10992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35974472..35974900 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001525 (Tubb5) NM_011655 tubulin, beta 5 Gene [Source:MGI (curated);Acc:Tubb5-001]

 
Come back to gene ENSMUSG00000001525


For any suggestions or comments, please send an email to unitrap@crg.es