Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14521A3
Clone ID IST14521A3
Vector VICTR74
Project tigm

Sequence tag IST14521A3HMR1
Sequence
NNCGGTTAGCTGAGACTATGTAGTCAGACCCCATCTTANAAAAACAAATAAAACAGCAGCCAGGGAGACGGCCCAGCGGG
TGAAGGTGCTTGCTGCCAAACTTGACAGCCTGAGTTCTGTCTCCAAGACCCACACAGTGGAAAGAAAAGAGCCAACCCCA
CACCTGTGCATTGGCACCCCCACCCCTGCCCCACACATATGTAAATGCANTAATTAAATAAAACAAACAAACATAAGCCA
CAGTTCATCTCACTCTGAACATCCATTCTTGTATTCANAATTANNNACTTANTCNGGAGGTCTTGGGGCTGTGANATTCT
TGTCATTTGTATGTTTTCATTTATGAAGGGCGTCCCTGGATAACGAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20327836..20328204 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]


Sequence tag IST14521A3HMF1
Sequence
GTGGAACCCAAGATACTCAAGATACTGGGGTCACATAGTTGTACCAACACCCCCTCCCCGCCAACACCAAGAGTAGTGCT
TTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20328204..20328298 95
NO GENE  

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es