Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12061F2
Clone ID IST12061F2
Vector VICTR76
Project tigm

Sequence tag IST12061F2BBF1
Sequence
CTGGCCGCGCCGACTGAAGCACCTGACGGCGGAGGGAGGCGGGCGTGCGGCCCAGGACGGAGGGAGGATTCCGCGCCAAT
CCGGGGGATAGCGGCGTTTGTTGTTGTGTGGAGGAAGTCCGGGATGGCGCTTGGCTGGGCAGAAGAAGAAGCACCTTGGT
GAGGCCGANAAACGCGGGAAAAGGAAGAAGGAAGGGCTCGCTTGATTCCACCANANCTCCGGGGTTTTACCGTATGAATA
ANAAAGCAGGCTTCCGTTATTTGGGTGCANTCTGTCTGTCTGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTAGA
GTGTGTGAGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI4963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94182548..94182889 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]


Sequence tag IST12061F2HMF1
Sequence
CTGGCCGCGCCGACTGAAGCACCTGACGGCGGAGGGAGGCGGGCGTGCGGCCCAGGACGGAGGGAGGATTCCGCGCCAAT
CCGGGGGATAGCGGCGTTTGTTGTTGTGTGGAGGAAGTCCGGGATGGCGCTTGGCTGGGCAGAAGAAGAAGCACCTTGGT
GAGGCCGAGAAACGCGGGAAAAGGAAGAAGGAAGGGCTCGCTTGATTCCACCANAGCTCCGGGGTTTTACCGTATGAATA
AGAAAGCAGGCTTCCGTTATTTGGGTGCAGTCTGTCTGTCTGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTAGA
GTGTGTGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI4963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94182532..94182889 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]

 
Come back to gene ENSMUSG00000020863


For any suggestions or comments, please send an email to unitrap@crg.es