Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14305E1
Clone ID IST14305E1
Vector VICTR74
Project tigm

Sequence tag IST14305E1HMR1
Sequence
AACCCATATATGTACACACATCTTCATAAAGGTCCTCCTTAAGAGCTCGAGTCTCAAGGTCTAGGGCCTGATGTCACATT
CTGCGCTGTGTTAGGTTCTTTGTGTCCACCGACAACACTTGGCCTCCGACTTTCACAAGTTTGTTTGTTTGGGTTTTTTT
TTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127386187..127386352 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14305E1HMF1
Sequence
GGTTGCTCTGACAGTTAATGAGGGAAACACACAAAAATGCATGTACATGTACACCTGGTACGTTCTTCCAAGTTCTCAGC
TTGCTTTTGCTTTTTAATCGTGTAAGTGAGCTTGGAATTTTGAGCAACCGCTCCAAAATAAAAACAATACAGCGTTTGTT
ACGTGTCTGGTTCTAAAAGTCAGGCAATCAACGTGAGCTCTTCTGCCTGCCANTGCCTGTCCTTCTGCGAGTGGCCTGCC
TTTAGTAACCATCTCTGATTTTATTTTCCTGCACAGTGAGAAGGANANCANAAGGTCNGCCAACAANTGGGGGANAANGT
CCCNGANANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127386349..127386674 308
 
EST/CDNA Est Name
  BB856728.1 - AA387679.1 - AA387504.1 - BY243190.1 - CF156992.1 - BI789298.1 - CJ166545.1 - BY272461.1 - BY245915.1 - BE286021.1 - CX222847.1 - BY277313.1 - BY290584.1 - BY251934.1 - BY250683.1 - BY246304.1 - CB597593.1 - BY061595.1 - BY026963.1 - AL364524

 
Come back to gene BB856728.1 - AA387679.1 - AA387504.1 - BY243190.1 - CF156992.1 - BI789298.1 - CJ166545.1 - BY272461.1 - BY245915.1 - BE286021.1 - CX222847.1 - BY277313.1 - BY290584.1 - BY251934.1 - BY250683.1 - BY246304.1 - CB597593.1 - BY061595.1 - BY026963.1 - AL364524


For any suggestions or comments, please send an email to unitrap@crg.es