Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P144C03
Clone ID P144C03
Vector ROSAbetageo0
Project ggtc

Sequence tag P144C03
Sequence
GCTGTGGAATTTACATCATAGCCCAGAACTCGAGGCGTCTGCTTAACCCGGCTTCTCAAATGTTGGCCTATAG
Sequence Type mRNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 46480794..46480866 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079575 (AC158680.4) NP_001074396 SUH_MOUSE Isoform 2 of P31266 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:P31266-2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947070..53947142 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es