Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P144B02
Clone ID P144B02
Vector ROSAbetageo0
Project ggtc

Sequence tag P144B02
Sequence
GGGCTCTGGCTCTACGGGTTGGCGCGAGAGTCAAAAGGCTTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGGCATT
CGCGTACTGAGTGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444615..180444749 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SP144B02
Sequence
AATTCTGGAATGCTTCTGGAAGGAATGTTGGTCCGTCCGCCCTGAGATGTTTGGGTGTGCTTGTTTAAAGATGAACTGTC
CAGGGAAAGCAACTTCTCATTGAGTCACTGAAAATAAGACCAGTTTAGCAGATCTGTCAGACACAATGACCACAGTGGCA
GTCTCTTAACTCCATAGCTCTACCCGAAGCTATCCAGGTTGGTATCGACAAACTTTGTAGCACTTACTTTAACTCTGGGT
AAAGTTGGATTATCAACTCAAACTTGTGCAAGGGAAGAGGCTGGTATCATGAGGAGAGAAGAGGGTTAACTCAGAATGTT
AATGCCTCTGTGGATGGTG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443554..180443892 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SP144B02
Sequence
AACTAGCTCCTGTAGAGGGTTCTTCAGCTGCTTGACTTTGAGCTCATCTTTGCTGNNNGCATGACATTGTCACATATTGT
CCTCCCAGTACTATTTTCTCCTACACCCTGACCTTTCTTTCATGTAAGGCATTTTTTTCGCCAGATGATTGCACCCGGAC
TCCTGTTGTTCACTTTGGGCTGTGAAATGCTCCCCTCCACTGCTTGGGCTTCCCTGGGAAGTTCCACTAAATACCAGCAA
GTTTTGTCTTTTCCTTTTGCTCAGGTGATAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es