Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14495C7
Clone ID IST14495C7
Vector VICTR74
Project tigm

Sequence tag IST14495C7BBF1
Sequence
GTCGGGGCTTCAGCGGTCTGGCTAAGGGTTGCTCAGTCAGTAGGGGGTAGAGAGCCCTGGGATGCCGCATAGCCCTCCAG
GAATCCAAGGCAGTCCCTGTCCTGGCATTCAGGCCATTGTAAATAATCCTTATAAGCCCATTATCTTAGCANAGCGCTGG
GAAAGAGACACAGAAGGGCAAGATAAAACAGAGCTGTGGTATTTAGTGCAGCGTGTTTGGCGAACAGCTTCGGGAGCTGC
AGATGTNAGGACACACAGCGCAGGGTGAAGGGCCAGCATCTAGGTTGTTAATCCACCCCAGANTTCTAGCCNGACTCTAA
GGCATGCCATGCCATTGTGTGGCTTGTGGGTTTCTGTACCTTTGTTTTCTTCCCTGGANTGATCGTGAAGGTCAAAAGGG
AGGANATGANTGAAAGCCCCTCCCTGTTACNGCTGGTGGATCTCTGAAACAGCNNGGATCT
Sequence Type genomic DNA
Unitrap ID UNI580

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101971651..101972110 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027860 (Vangl1) NM_177545 vang-like 1 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2159344]


Sequence tag IST14495C7HMR1
Sequence
TTGGGACCCCTGACTGTGAGCCNGAGGCTGGGGGACAGGGCACTGTGGATGTCTGTGTGCACACGAGTACAAATGTGTGT
TANTGCACATCCGTGCAGAGCATCTGTACCCATGTANCATGTGTCANGGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI18786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 125240239..125240369 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001985 (Grik3) NM_001081097 glutamate receptor, ionotropic, kainate 3 Gene [Source:MGI (curated);Acc:Grik3-001]

 
Come back to gene ENSMUSG00000001985


For any suggestions or comments, please send an email to unitrap@crg.es