Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14070A7
Clone ID IST14070A7
Vector VICTR74
Project tigm

Sequence tag IST14070A7HMR1
Sequence
GACTCATGATACCTGTTGTCNCGTCTCATAGCTGGAACTAAAATGTAAGTGGAATATGTGTTTTGCTTTGTTTTGTTTTG
TTCATTGGAAACAGGTTCTTATGTAGCCCAAGCTGGTCTCAAACTCTGTGTAGCTAAGGATGATAACTTTGATCTTCTGA
GCCTCTTGCTTCACCTCCCAAGCGCTGGGCTTGCAAGCATGTAGCACGGTC
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154291104..154291313 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es