Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10493A8
Clone ID IST10493A8
Vector VICTR76
Project tigm

Sequence tag IST10493A8HMR1
Sequence
GGANNNCCGACTGTGCGGTGCTGTGAACGCTCAGGCTCCCTGGTAGGCAGACGGGCACCGCCTCNAGTTTATTCAGGAAG
GTTTGAGCAGGAATTCCAGTGTTGGGCTTTTANCTTCTACGTTTTCTGAACCGCTGTATTTTGCGTGGTGGAAGACTGCT
GAAAGAAATTGCATGTCTGGTAAACTTCCCCCAGCATGTTTCCAAGTCTGGTCCACGGTCCCGTGTTTCAAGCCCGTTAA
GTACTTACTGACCTACAGAATGTATCCAGCACAGTCNATGAACTAATGTGTCTTGCTGATATAAAAACGCCTANGATGTG
GA
Sequence Type genomic DNA
Unitrap ID UNI29519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40505361..40505675 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es