Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14770G12
Clone ID IST14770G12
Vector VICTR76
Project tigm

Sequence tag IST14770G12BBF1
Sequence
AGCATCAGGGAGCCAGAAAGCCCAGGCAGGGATCAGAAAAAAGCATTCTTAAGTTCTGCCAGCATCCGAAGAAAAGACAC
AAAGAAAGTGAAAAGTTTCTAACTTGGGCCTCAGTCAGGTAGTTACTCATGGTGGCTCCTAGTCACTACACTGAGCACTG
AGCATCTTGGGAAGAAAAAGCACAGTTATCTTATTAAAGAAGAAATTATCCCAAAGCCAGACATGGTAGCACTTGCCTTT
AATCTGAGCACTCAGGAGGAAATAAATAAATAAATAAATAAATGAAAAAAATGCATCTCACTTTGGCATGGCTTAGAATG
ATTCTGCCTTCCTAGTGTGGTCTCTTGACCAGATGACCNATGCAGCCCTGTTGGAATGATTGGTTTCTGTACAGGCCAGA
NATCTG
Sequence Type genomic DNA
Unitrap ID UNI31425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120809557..120809961 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054484 (Tmem62) NM_175285 transmembrane protein 62 Gene [Source:MGI (curated);Acc:Tmem62-001]


Sequence tag IST14770G12HMF2
Sequence
ATTACGGGTGGTTGTGAGCCACCGTGTGGTTGCTGGGATTTGAACTTCGGACCTTCGGAAGAGCAGTCGGGTGCTCTTAC
CCACTGAGCCATCTCACCAGCCCTCCCCCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261812..14261917 106
NO GENE  


Sequence tag IST14770G12HMR1
Sequence
TATATCTGTCAATCCCCTGAGAGATCACTGACGACTCCATGTGTCTGAGCAATGCCTGCGGGGATGGGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130101258..130101329 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000080610 (SNORD110)  

 
Come back to gene ENSMUSG00000080610


For any suggestions or comments, please send an email to unitrap@crg.es