Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10111A10
Clone ID IST10111A10
Vector VICTR76
Project tigm

Sequence tag IST10111A10BBF1
Sequence
TCTTGACCTCGCTGCCAAGGCCCAAAGCTCCGGGTCTTGGAACTATGCTCATTGCCTTTCCCCGGACAGGCCCACAGGGA
TCTCGAATGTCTCACATCGAGCAGGTGAGCCAGGCCATGTTTGAGCTGAAGAACCTGGAATCTCCCGAAGAACTTATCGA
GGTCTTCATTTACGGCTCTCAAAACAACAAGATTCGGGCTAAATGGATGCTTCAGTCCATGGCTGAGAGGTACCACCTGC
GCCAGCAAAAAGGTGAGAGTCTCTAACAGGTGCCCTGAACCAAGGTGCGGTGGAGTAGCCTCCTGCCTCCACCGAGTTTA
CCTCCCTTTTCACATCTCCACTGCTTGCATCCCTCTGAGGATGCCTTACTTTTGGGCATCACCTGGGACTCCTCCTTGGT
CTCTAGGCCGTCTCTGACAACCTTTTGGGAGTTCGGGGGCCCAGACGTAAGTCTTAATGTGAGAAGGGGTAGGGACTTAT
CCCTCTGGGCAGGGTTATCTGACGTAACCCTGCCCCACCCCACTCCCATCTCCAGGTTTCTAGGAGAACGT
Sequence Type genomic DNA
Unitrap ID UNI17962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78215229..78215779 547
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060461 (Dppa5a) NM_025274 developmental pluripotency associated 5A Gene [Source:MGI (curated);Acc:Dppa5a-001]


Sequence tag IST10111A10HMF1
Sequence
TCTTGACCTCGCTGCCAAGGCCCAAAGCTCCGGGTCTTGGAACTATGCTCATTGCCTTTCCCCGGACAGGCCCACAGGGA
TCTCGAATGTCTCACATCGAGCAGGTGAGCCAGGCCATGTTTGAGCTGAAGAACCTGGAATCTCCCGAAGAACTTATCGA
GGTCTTCATTTACGGCTCTCAAAACAACAAGATTCGGGCTAAATGGATGCTTCNNTCCATGGCTGANAGGTACCACCTGC
GCCAGCAAAAAGGTGAGAGTCTNTNACAGGTGCCCTGAACCAAGGTGCGGTGGANTANCCTCCTGCCTCCACCGAGTTTA
CCTCCCTTTTNACATCTCCNCTGCTTGCATCCCTCTGANGATGCCTTACTTTTGGGCATCACCTGGGACTCCTCCTTGGT
CTCTANGCCGTCTCTGACNACCTTTTGGGAGTTCGGGGGCCCAGACGTAAGTCTTANNGTGAGAAGGGGTAGGGACTTAT
CCCTCTGGGNANGGTTATCTGANNTAANCCTGCCCCACCCCACTCCNATCTCN
Sequence Type genomic DNA
Unitrap ID UNI17962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78215248..78215779 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060461 (Dppa5a) NM_025274 developmental pluripotency associated 5A Gene [Source:MGI (curated);Acc:Dppa5a-001]

 
Come back to gene ENSMUSG00000060461


For any suggestions or comments, please send an email to unitrap@crg.es