Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P143D02
Clone ID P143D02
Vector ROSAbetageo0
Project ggtc

Sequence tag P143D02
Sequence
CCCCNNNNAGCGAAGGCGGGGAGCGCAACCACGAGACGGCCTTCCAGGGCATGCTCCGGAAACTGGACATTAAAAACGAA
GGCGATGTTAAATCTTTTTCTCGAGTAATGGTCCATGTTTTCAAAGATGGCGTAACAAACTGGGGCAGGATTGTGACTCT
TATTTCTTTCGGTGCCTTTGTGGCCAAACACTTAAAGAGCGTAAACCAAGAAAGCTTCATCGAACCATTAGCAGAAACTA
TCACAGATGTTCTTGTAAGGACGAAACGGGACTGGCTTGTCAAACAAAGAGGCTGG
Sequence Type mRNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95463372..95463931 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]


SPLK-Sequence tag 5SP143D02
Sequence
TGAGGTTTCTGCTNTTTCTTCTCAGGCATGCTCCGGAAACTGGACATTAAAAACGAAGGCGATGTTAAATCTTNNNCTCG
AGTAATGGTCCATGTTTTCAAAGATGGCGTAACAAACTGGGGCAGGATTGTGACTCTTATTTCTTTCGGTGCCTTTGTGG
CCAAACACTTAAAGAGCGTAAACCAAGAAAGCTTCATCGAACCATTAGCAGAAACTATCACAGATGTTCTTGTAAGGACG
AAACGGGACTGGCTTGTCAAACAAAGAGGCTGGGTAAGTTCGTCTTGTGATATAAAGGGACCGTGGAGTGGAAATGGGGT
GCAGGATTTTGTGAAGGAGAAGGCACCTAGAGGGTTTTTACAAAGTTTCTCTCCGGTTTCAGATTTAATTTATGTATCTC
TTGTTGCATGATGTTGGTCGTTGTAGGTGGTAGGTCCAGAGAAAAACTCATTATGACGGTCTTGAATTGTACCAAAAGGT
CTTGTATTCTGTAGGTTGTACTTCTAATTCAGTTGGATAATCTTCAGAGCAGTGGATTCAAACCGTGAAGAAGTAAGAGT
CACCTGTGATGACTAAATTACATCCCCCTCATTTTAATCAAATGGATAAGGGGTAGAGCCTGCATTTTAGAAGTTAATAC
CCAAATACACCAGCTCTGGTGTAAGGTGCACTCATTCTCATTAGGAAATACCCATGGGAGAAATACTACATGGGGATGGA
TCCAAAGAGTGGTTGGTTATGGGCCCTGCTCAGTCTGTGCAAAAATAATTGAGGTGCAAGGCAACTGCTGTAAGGTAACT
GTTGTGTGGTTACTCACTGGAAAGAACTCCAGAAGTGTCTCTTGCTCCCCAG
Sequence Type genomic DNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95463659..95464510 831
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]


SPLK-Sequence tag 3SP143D02
Sequence
ATTTTAATTCACCGCATCTCTGTATGTAGTGTTACAACAGCAGAAACCCATACTTGAAAATGTGCTTTTCTTTTTTGTTT
TCTAGGATGGGTTTGTGGAGTTCTTCCACGTACAGGACCTAGAAGGCGGCATCAGAAATGAGCTGCTGGCTTTTGCGGGT
GTTGCTGGAGTAGGGGCTGGTCTGGCATATCTAATAAGATAGCCTTGTGAGTGCAATAGGGGACTCTTAAAGCTCCAGCC
ACCAAACTACATGCATCTGTGAAAACATGTGTATTTATGAAGGTGGACTTGAAGCTGCCCAGGATTTTAACAGTCCAGTT
CTACTGTAGCAACATAGCAAAAAGAAAGTGGCTACAGGATTGTGGCTAACAAGAATAAATACATGGGAAAAGTGCTCCCC
CTGGAAGAGTCACTGTCTGAATGAAGCAAAGTTCCCTCTCAGCAAACACTGAGAGGCCATGGAGAAGGACTTCTAGAATG
AATNNNAGGGGTGGATGGAAAGGTTTGATTTCCTATCTAGAGATGGAAGAGGGGCCAGTCATCAGGCTAGTCACAAAGCT
CAATAAATATCCATTACTCTGCTCAGAGTGTTGAGAGAGAAGCCCTAATTAACAACGTTGGTGACTTGTGNNNNATGGAT
TTGTAACCNNNCAGTCACCCAACGATGACTAGAAGCTGCAGTGCTGTACAGGAATGTGAAGGGAGGCCTCTGAGC
Sequence Type genomic DNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95464545..95465259 685
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es