Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0873
Clone ID CH0873
Vector pGT0lxr
Project sanger

Sequence tag CH0873
Sequence
GCCGAGAAGGAGTCATTGACGGAGGATGAGGCCACGCAGTTCCTCAAACAAATCCTAGACGGTGTCCACTACCTGCACTC
CAAGCGCATCGCACACTTTGACCTGAAGCCCGAGAACATCATGTTGCTGGACAAGCACGCAGCCAGCCCCCGCATTAAGC
TCATCGACTTTGGCATCGCGCACAGGATCGAGGCTGGCAGCGAGTTCAAGAACATCTTTGGCACACCCGAGTTTGTCGCC
CCCGAGATCGTGAACTATGAGCCACTTGGCTTGGAGGCTGACATGTGGAGCATTGGCGTCATCACCTACATCCTCCTGAG
CGGAGCGTCCCCATTCCTGGGCGAGACCAAGCAGGAGACGCTGACGAACATCTCAGCAGTGAACTATGACTTTGATGAGG
AATACTTCAGCAGCACCAGCGAGCTGGCCAAGGACTTCATCCGCAGGCTGCTGGTCAAAGACCCCAAGAGGAGGATGACC
ATCGCACAGAGCCTGGAGCATTCCTGGATCAAG
Sequence Type mRNA
Unitrap ID UNI1401

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80652937..80655087 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034974 (Dapk3) NM_007828 death-associated protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1203520]

 
Come back to gene ENSMUSG00000034974


For any suggestions or comments, please send an email to unitrap@crg.es