Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14601B11
Clone ID IST14601B11
Vector VICTR74
Project tigm

Sequence tag IST14601B11BBF2
Sequence
TTGGTCCCTGAGAAATCGGGAAAACCATTACCCACATAGGCCAGGCTCCAGAGAAATGGCCAACTTTTCTCTGGAGTTGG
AGTTTGAGTGTTTATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84857813..84857911 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14601B11HMR1
Sequence
ATGTGGAGGCAAGAATCAAACCTGGATTCTCTGAAAACAACCGCTGCTTTTAACCNGAGTCACCTCTCTAGTTGATTTTT
TNAAATTTAAAACTACAGGGCACAAAAATGTTCTCACATCTTGGACAACTGCTATCATGGTTATAACTTGTATAATTTTC
AAGACTTTGACAATGGGTATGTACTAATAGGTGATTTTAATTCTGAAAATAAAATAAAGTGTCTTTAAGAAAAAGANGAC
TGANTATCTACTTGATTTCTAACTTCTAGCCTTTCTAAAACGGGTTTNAATANATCNGTAGAGGTGAAGTCCTGCATGTA
NAATGGGATGCTCTAGGACTGTTCANTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95445335..95445683 327
 
EST/CDNA Est Name
  CJ244363.1 - CJ244233.1 - CJ244216.1 - CJ244246.1

 
Come back to gene CJ244363.1 - CJ244233.1 - CJ244216.1 - CJ244246.1


For any suggestions or comments, please send an email to unitrap@crg.es