Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10703C7
Clone ID IST10703C7
Vector VICTR76
Project tigm

Sequence tag IST10703C7BBF1
Sequence
TTGTCAGCTATGTGATGGCTAATGATGAGGTTTTTGTTTTGACACAGGGTCTTACTGAGTAGCTCCCACTGGCCTGACCT
TGTTTGCCTTTCCACTGCTAGGATTAAAGGCAAGAACTCTCAGGCCTGGAGAACAATGGATTTTTTTTCATGTTTTTATT
TAGTANATTAATCAAAAGATTAGACAGGGTGGCCTGAAACTTGCTGTGTANACCAGGCTATCCTTGGACTCACAGAGATC
CACCTGCCTTTTCCTCCCAAGTGCTGGAATTAGAGGTATGTGCTACCACACCTGGCCTTTGTTTTTGCTTTTCCTTTGAC
TCTTGATTTTTTACATTTGTAAGTGTGCAGGTGTGTTTGGGTGTGGAAGCCCGATGACTTCNNGGGCNNTTCTTNAACAT
TCTTNNNNCATTATCTTTTTTTTTTTN

Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86593014..86593439 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]


Sequence tag IST10703C7HMF1
Sequence
TTGTCAGCTATGTGATGGCTAATGATGAGGTTTTTGTTTTGACACANGGTCTTACTGANTANCTCCCACTGGCCTGACCT
TGTTTGCCTTTCCACTGCTAGGATTAAAGGCAAGAACTCTCAGGCCTGGANAACAATGGATTTTTTTTCATGTTTTTATT
TANTANATTAATCAAAAGATTAGACAGGGTGGCCTGAAACTTGCTGTGTANACCAGGCTATCCTTGGACTCACAGANATC
CACCTGCCTTTTCCTCCCAAGTGCTGGAATTAGAGGTATGTGCTACCACACCTGGCCTTTGTTTTTGCTTTTCCTTTGAC
TCTTGATTTTTTACATTTGTAAGTGTGCANGTGTGTNTGGGTGTGGAAGCCCGATGACTTCNNGGGCN
Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86593053..86593439 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es