Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15037F11
Clone ID IST15037F11
Vector VICTR78
Project tigm

Sequence tag IST15037F11BBF1
Sequence
AAGGCTTTTTTGAAAAAGACGATGGTTTGGTCATGTTTAAGAATATTCTAGGGGCTGGCGAGATGGCTCAGTGGTTAAGA
GCACTGACTGCTCTTCCAAAGGTCCTGAGTTCAAATCTCAGCAACCACATGGTGGCTCACAACCATCCGTAATGANATCT
GT
Sequence Type genomic DNA
Unitrap ID UNI31436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13105066..13105226 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042414 (Prdm14) NP_001074678 PR domain containing 14 Gene [Source:MGI (curated);Acc:Prdm14-001]


Sequence tag IST15037F11HMF2
Sequence
CATGGGATAACATTCTCCAATCACAGAGAGACTTCTCAGAGAAACCTGCTTTGTAACCTGGTACATGACACACACCAAAA
CATGGTTTTTAGGAAATACTGTCTAGAACGACCTGTACCTTCATGTTTTGTTTTAATGTTCTCTTAGCTTTGAAATTCAN
ATTAAAAATTTCTGTACTAAGCTAGAAGCTGTACANAAGCAGGGATGCCTCTCTACTGCGACCCAGCCCCACTCCATTCC
ANGCCTTCCTCCCNAAAAGCNNATGTGATGCATCANTTTAAAACTCACTGCTTTCACTGGANGANACCCNNTGAANAANC
CCNTCNTGTCNTTNCNAGGTTNCNANGTNNCNCTGGANNGNNGCNNACCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042414


For any suggestions or comments, please send an email to unitrap@crg.es