Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13943G3
Clone ID IST13943G3
Vector VICTR74
Project tigm

Sequence tag IST13943G3HMF1
Sequence
CACCCCAAAGCCAACATTGGAGGCCTGGAATGGTTGAAGTTTTGCCACAGAGAGAAGGCATGTCTCTTTGGAATATGGAT
GCCATCTGATAGAAAGCTTCCTTTTGCAAAAACAGCTTTCCTGGGAAAAATCGGTCCTTCATTCTCTCCCTGGCCCCTAC
TACGATCCCCAGGGGATCAAGTTTACAGAAAATCCAATCTGAATCTGATGTATTTATGACCTGGTTCCTTCCATCCTTCT
ATCTGTCCTCCTCAGANAGGGTTAATGTTTGGATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI30020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71027322..71027600 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es